Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14472E8
Clone ID IST14472E8
Vector VICTR74
Project tigm

Sequence tag IST14472E8HMF1
Sequence
TGACACTGAAACAAAGAAAGAGCCTCCACCCATGTGCAAGCCAAACCTCATCCCCTAGGCTCTTTAGCTGAAAGGAAAGA
CAAAGGTCTTCTGTGAAACAAAGAACCAGGAAGGACCCAGTGACCACACATGGTCCTACCTTACCAGCCTGAAGCAAATC
TCAGGCCTAAAAGCCACAGCCTCTCAGTGTGGCTGAGACCTCATCTTTACTAGGAGGGAGTGAACCGGGGCTGAGTTCAT
CTGCACTGAATCTCTCCNAGGTGAGGTTTTAGTTCTCTGGGATACCAGGGATTTGGGGGACAGTTGTATNANNNGNGAGG
CTGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44721451..44721774 312
 
EST/CDNA Est Name
  BB852769.1


Sequence tag IST14472E8HMR1
Sequence
CCTTTATATGACAATTTTAATGTTATATGCCTGTCTGCATTGGTGGGAGAGAATTCTAGAATCGGATGACTGAGTTGTAA
CTGTCAGTTGTCTATTCTGTTAGTGTTAGCTAAAGGTTTCATACAAAAGTTGTATTTGAGACTTATATGCATACTTGCTT
CATATC
Sequence Type genomic DNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44721266..44721431 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]


Sequence tag IST14472E8BBF1
Sequence
TGACACTGAAACAAAGAAAGAGCCTCCACCCATGTGCAAGCCAAACCTCATCCCCTAGGCTCTTTAGCTGAAAGGAAAGA
CAAAGGTCTTCTGTGAAACAAAGAACCAGGAAGGACCCAGTGACCACACATGGTCCTACCTTACCAGCCTGAAGCAAATT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44721451..44721609 159
NO GENE  

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es