Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11069H12
Clone ID IST11069H12
Vector VICTR76
Project tigm

Sequence tag IST11069H12HMF1
Sequence
ACAGATAGTTATGTAGTGGTCATACTGCCTGAGAGCTGAATCTGGACAGTTTCACCACTTCTGGCTAAGAATGCAGCCTC
TGTAACCTTACTGATCTCCTAGGCTCTCAGGTGTTCTGTAGGAGGACATAGATTACTATTACTAGTCATCTTTACCAGGA
GAGGATGCCAGCCTTGGACGTTTATAGGTAGTCACTAGTAAAAGAGCATGCGTGACGCTGCCTGTCCTGGCACGTGTCCC
CGATGGACCTGTATGTGGTTTGTAGAGTCTGGAATCTCAGANCTAGAAATCTCAGTGTTAGTGCTGATTATTCTGTCNAA
GCCTCTGAATGCCTGTCCTCTCTGTTNAGCAGGGACATTTGTGAACATTTCAGGACACAGAACATAAATGGCTGGAACTG
TAGCTCNNGGGTAGAGTATTTAGCATGTACAAGATCCTGGGTTTGACCCTCANCACCAGGNNATGGAACACAGAACCCAG
TGAGGGTGTTCTAAACCTCNNGGTNANTCTTTCTNGGGN
Sequence Type genomic DNA
Unitrap ID UNI34912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 93442910..93443427 492
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026311 (AC109199.10) NM_023046 Ankyrin repeat and SOCS box protein 1 (ASB-1) [Source:UniProtKB/Swiss-Prot;Acc:Q9WV74]


Sequence tag IST11069H12BBF1
Sequence
ACAGATAGTTATGTAGTGGTCATACTGCCTGAGAGCTGAATCTGGACAGTTTCACCACTTCTGGCTAAGAATGCAGCCTC
TGTAACCTTACTGATCTCCTAGGCTCTCAGGTGTTCTGTAGGAGGACATAGATTACTATTACTAGTCATCTTTACCAGGA
GAGGATGCCAGCCTTGGACGTTTATAGGTAGTCACTAGTAAAAGAGCATGCGTGACGCTGCCTGTCCTGGCACGTGTCCC
CGATGGACCTGTATGTGGTTTGTAGAGTCTGGAATCTCAGANCTAGAAATCTCAGTGTTAGTGCTGATTATTCTGTCNAA
GCCTCTGAATGCCTGTCCTCTCTGTTCAGCANGGNCATTTGTGAACATTTCANGACACAGAACATAAATGGCTGGAACTG
TAGCTCNNGGGTAGAGTATTTAGCATGTNCAAGANCCTGGGTTTGACCCTNANCACCNGGAGANGGAACACNGANCCCNN
TGAGGGTGTTCTNANCCN

Sequence Type genomic DNA
Unitrap ID UNI34912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 93442910..93443406 459
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026311 (AC109199.10) NM_023046 Ankyrin repeat and SOCS box protein 1 (ASB-1) [Source:UniProtKB/Swiss-Prot;Acc:Q9WV74]

 
Come back to gene ENSMUSG00000026311


For any suggestions or comments, please send an email to unitrap@crg.es