Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13066A8
Clone ID IST13066A8
Vector VICTR76
Project tigm

Sequence tag IST13066A8HMR1
Sequence
CTAGAATGATTGTGGGAATAATAACAACCAGAAATTACATCGTAAAGGGTTGGGTTAGGGGTGGTAGCTCAAGTATGCTG
ATCTTTTTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI35992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18907932..18908026 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022702 (Hira) NM_010435 histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Hira-001]

 
Come back to gene ENSMUSG00000022702


For any suggestions or comments, please send an email to unitrap@crg.es