Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10967C1
Clone ID IST10967C1
Vector VICTR76
Project tigm

Sequence tag IST10967C1HMF1
Sequence
CCACAAGNTCTAGATGGACCAGATGGACCAATCACTGACATTTGATTCACAGACAAAGCACCAACTTTAGGACCACTGCA
GACTGGACTTGAAGTCCACCTTAGACTCCTGCAGGGGC

Sequence Type genomic DNA
Unitrap ID UNI35993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33729999..33730115 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es