Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14843H2
Clone ID IST14843H2
Vector VICTR76
Project tigm

Sequence tag IST14843H2HMF1
Sequence
CTGTTTGCTTTGTGGGTTATAGTTCTTCTGCCAATGAGAACCCCAGGACCAACGCATGAACTTGAGCCTGGAAGTAATTG
AGAAGAAACAGGGTTCATGACCATAATCCCGGCACTCAGGGTTGCTGTGAGTTTCAGGCCAGCCTGAGCAGCAAACAAAC
AAAAAAGAAAAAGAAAGGAAATATTTGAGAGGAAGGGATCAAAGGAAGTGAGAGAGAAAACATAAGAACGATTCTATTCT
TATTTTTATATTTAATAAAGAGCTGTGATAAACATCTGTACAATCAATGCACAGAGTTAGGCCTCACTTCCTTGTGGACC
AACTATCCATACATTAAATATTTGTTTAGCATTCCTAGTGTTAGGCACCGTGCCCAGCCCTAGGAAAGACAGATGGAAAG
ANAACTGTCCTANGGGAACCGTCCTATCTCGCANGGGGACACANGCNATAGTCCTCTCATGAGATAACNATCCNNCCTGG
A
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117086582..117087061 464
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14843H2BBF1
Sequence
CTGTTTGCTTTGTGGGTTATAGTTCTTCTGCCAATGAGAACCCCAGGACCAACGCATGAACTTGAGCCTGGAAGTAATTG
AGAAGAAACAGGGTTCATGACCATAATCCCGGCACTCAGGGTTGCTGTGAGTTTCAGGCCAGCCTGAGCAGCAAACAAAC
AAAAAAGAAAAAGAAAGGAAATATTTGAGAGGAAGGGATCAAAGGAAGTGAGAGAGAAAACATAAGAACGATTCTATTCT
TATTTTTATATTTAATAAAGAGCTGTGATAAACATCTGTACAATCAATGCACAGAGTTAGGCCTCACTTCCTTGTGGACC
AACTATCCATACATTAAATATTTGTTTAGCATTCCTANTGTTAGGCNCCGTGCCCAGCCCTAGGAAAGACAGATGGNAAA
GAAAACTGNCNNANGGGAACCGNCCNANCTCNNANGGN
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117086632..117087061 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es