Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12358A4
Clone ID IST12358A4
Vector VICTR76
Project tigm

Sequence tag IST12358A4HMF1
Sequence
ACACAAGGTCTCACATCTGAGGTTGGTCTTGAACTCACTATGTAGCCCTGGATGTGCCACTATGCCTGGCTATATACAGT
ACTGGGGATTCAAATCAGGGTTTCAGTCNTCTTANGNNNNCATTCTANCNCCTGAATGANATCNNCNNANTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12358A4BBF1
Sequence
ACACAAGGTCTCACATCTGAGGTTGGTCTTGAACTCACTATGTAGCCCTGGATGTGCCACTATGCCTGGCTATATACAGT
ACTGGGGATTCAAATCAGGGTTTCAGTCATCTTAGGCAAGCATTCTAGCACCTGAATGATATCAGCAGACTCTAAAGACT
GTTGACAGAAAAGAGCCGTTTACAAAATAGTATGTAGAGTGATATCTTTAGTATCCTACATATCTCTGTGTATATGCATG
TAAAAGGAGAGGAAGGAAAGAAGACGAAAGAAGAGATACAGATACACATTAAGACAATAAAAGTGATGGTCTCAGCCTGG
CATGGTGGTGCAACATCTGTAATCCTAGCACCTGGGAGGTGGAAGCATGAAAATCAGGAGTTCAAAGCCAGCCAGAGCTA
TATAACAAGAGCCTGTTTTACAAAACCNAAAGAAAAAGAAAAAAGACAGTGGTCTCAAGTNAGTATGGTGGTACACATCT
ATTATTCCAGN
Sequence Type genomic DNA
Unitrap ID UNI30521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34378326..34378815 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]

 
Come back to gene ENSMUSG00000006423


For any suggestions or comments, please send an email to unitrap@crg.es