Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11645F3
Clone ID IST11645F3
Vector VICTR76
Project tigm

Sequence tag IST11645F3HMF2
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTACGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAG
ATCTGATGCCCTCTTCTGGAGTGTCTGAANACAGCTACNNTGTACTTACATATAATAAATAAATNTTTNNAAAAAAAAAT
GTTTTTNAAAAAAAAAAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148147653..148147831 165
NO GENE  


Sequence tag IST11645F3BBF1
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTACGGAGTTCANATCCCAGCAACCACATGGTGGCTCACAACCATNTGTAACAAG
ATCTGT
Sequence Type genomic DNA
Unitrap ID UNI14590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4614229..4614313 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4550212..4550296 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148147747..148147831 81
NO GENE  


Sequence tag IST11645F3HMR1
Sequence
NCTTACCCACTGAGCCNTCTCACCAGCCCCCTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154776380..154776415 34
NO GENE  

 
Come back to gene ENSMUSG00000009076


For any suggestions or comments, please send an email to unitrap@crg.es