Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14591C8
Clone ID IST14591C8
Vector VICTR74
Project tigm

Sequence tag IST14591C8BBF1
Sequence
AGACCTTTCAAACCTCTAAATTCTGAGAACCAGAAAAATCTTAGTGGATGACTTAGGGCTACATAAACTACTGGCATTAT
AACGGCTCTGCCCCCACCTTACAAAAATGAGGAAGGTGAGAGGTTTGGGGGAGGGAGGATGCTATGATAAACCCCTTGAT
TCTCCCTCTTGTTTTTAAGCTTCTGTTCTGTTATGTAACTCTAAAGCTGTCAGGTCAAATCCTGTCAAGTACTTTGGGCT
CTGCCCATGTAAGGCCTTAACAGATTCTACATGACTGAGAAAGCTTAATGGGGCCGTAAGCCAACTAGCTCATCAAAAGC
CGGACATAGAATGGGCAATGAAGTGTAAAAATTGTCCAAATNNATTCATAANTTAAATGTTAAGCTGGAGAATCTTGGCN
NAGCTGTACAGAAACATAAGCANANCTCTCACAAAAGAATCCCANGGCCAGCCCAAGANGCTCTATCTCTGCCTGGCAGT
AACNNNACCCTTCTNNTGGANTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97858089..97858588 472
 
EST/CDNA Est Name
  CX733968.1


Sequence tag IST14591C8HMF1
Sequence
AGACCTTTCAAACCTCTAAATTCTGAGAACCAGAAAAATCTTAGTGGATGACTTAGGGCTACATAAACTACTGGCATTAT
AACGGCTCTGCCCCCACCTTACAAAAATGAGGAAGGTGANAGGTTTGGGGGAGGGAGGANNCNNTGATAAACCCCTTGAT
TCTCCCTCTTGTTTTTAANCTTCTGTTCNGTTANGTAACTCTAAAGCTGTCAGGTCAAATCCTGTCNAGTACTTTGGGCT
CNGCCNATGTAAGGCCTTAACANATTCTACATGACTGANAAAGCTTAATGGGGCCGTAANCCAACTANCTCATCANAAGC
CGGACATANAATGGGCANTGAANTGTAAAAATTGTCCANATTAATTCNTAAATTAAATGTTANNCTGGANAATCTTGGCC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14591C8HMR1
Sequence
GTCTTTAGGATTAACCTTTCCAGTTGCATCGAATTACTAATGCCGTTGTAGTTGTAGAAGCCTGAAGACGGTAAGTAACT
TGTGTATGACTGTGAAGGTAGTGGTAGGGCTGACCCAGGGTCACAGGGTTCCAATTCCAGTGTTCTTTCTAATGTANAAT
ANAATATTAAATTATGAAATANTTAAAACTTAATGAAACATTTAACTGAAAAAATACTGATGTGTGAATTTGCATATTAA
ATACANATAATTATAATGGAAAGTGTATTTTTGTTGCCTGANCCCTTATTTTTTTGNGCTTCATTANTGGTGTGNNNCTG
GTCAAGTTTCTNAAANTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97858585..97858919 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es