Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13296B12
Clone ID IST13296B12
Vector VICTR74
Project tigm

Sequence tag IST13296B12HMF1
Sequence
TATTCCNCANGTGANAATTCTTTGTTCANTTCTGAGCCCCATTTTTAATGGGGTTATTTGATTTTCTGAAGTCCACCTTC
TTGAGTTCTTTATATATGTTGGATATTANTCCCCTATCTGATTTAGGATAGGTAAAGATCCTTTCCCAATCTGTTGGTGG
TCTTTTTGTCTTATC
Sequence Type genomic DNA
Unitrap ID UNI22185 UNI31994 UNI32398 UNI35994

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166380: 44034..44207 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161928: 193947..194120 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166390: 42286..42459 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 22908961..22909134 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052387 (Trpm3) NM_001035244 transient receptor potential cation channel, subfamily M, member 3 Gene [Source:MGI Symbol;Acc:MGI:2443101]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 33467669..33467842 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 41184936..41185109 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 27341986..27342159 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052276 (Ostn) NM_198112 osteocrin Gene [Source:MGI Symbol;Acc:MGI:2677164]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 19505333..19505506 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73262723..73262896 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 39258998..39259171 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11247718..11247891 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020193 (Zpbp) NM_015785 zona pellucida binding protein Gene [Source:MGI (curated);Acc:Zpbp-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 6463425..6463598 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7623573..7623746 164
 
EST/CDNA Est Name
  CN677307.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 15495653..15495826 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67037245..67037418 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 42117488..42117661 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 8872150..8872323 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078806 (AC132246.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 16166463..16166636 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 7546878..7547051 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3314826..3314999 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 59717382..59717555 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 21972561..21972734 164
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7473485..7473658 164
NO GENE  

 
Come back to gene ENSMUSG00000078806


For any suggestions or comments, please send an email to unitrap@crg.es