Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14413G2
Clone ID IST14413G2
Vector VICTR74
Project tigm

Sequence tag IST14413G2HMR1
Sequence
NTTGAGAAGACGTCCTCCTAGAGGGGCACGAGTGGACGTGTACGGTTGTCACCCGGCTCCTCTGTCGTGCTAGCCACATG
GTATGCGGTGCTCACGTGCAGCTAGT
Sequence Type genomic DNA
Unitrap ID UNI12090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 69526563..69526667 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027787 (Nmd3) NM_133787 NMD3 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Nmd3-001]

 
Come back to gene ENSMUSG00000027787


For any suggestions or comments, please send an email to unitrap@crg.es