Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10448F1
Clone ID IST10448F1
Vector VICTR76
Project tigm

Sequence tag IST10448F1HMF1
Sequence
TTGTGTGCGCNACCATCTGGGTGCTGANAGCACACACTACGTAAACTTTCACTGANAGTCACAGGTAGAGATATTTTTCT
CATCTCTGTAGTCTAGGCTGATTTCAATCTTGCAATGCANCTGANGATGACCTCNAACTCTTTTTTAAAAAACNATTTGT
TTATCTATTTAATCTGTATGAGTGGTGTGTATGTGCACAGTATGTGCCCTGTGCCCCTGGTACCTATGGTGGTCANAATC
NCAAATNNNCTNCTCAANAACTGGAAGTNNGGGTGGTTCTGTGTCACCNCNTGAGTGCTGGGAACAAACCTGGGTCCTCN
CANGAAGTGGTCTTNNCNTGACNTTGAACTCTTGATCTTCCTGGCTCTNCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TNTGTNTGTGTGTGTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10448F1BBF1
Sequence
TTGTGTGCGCGACCATCTGGGTGCTGAGAGCACACACTACGTAAACTTTCACTGANAGTCACAGGTAGAGATATTTTTCT
CATCTCTGTAGTCTAGGCTGATTTCAATCTTGCAATGCAGCTGAGGATGACCTCGAACTCTTTTTTAAAAAACGATTTGT
TTATCTATTTAATCTGTATGAGTGGTGTGTATGTGCACAGTATGTGCCCTGTGCCCCTGGTACCTATGGTGGTCAGAATC
GCAAATCAGCTCCTNAAGAACTGGAAGTAGGGGTGGTTCTGTGTCACCACGTGAGTGCTGGGAACAAACCTGGGTCCTCG
CANGAAGTGGTCTTCAGCCTGACCTTGAACTCTTGATCTTCCTGGCTCTACTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
GTNTGTGTGTGTGTGTGNGTN
Sequence Type genomic DNA
Unitrap ID UNI32127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136447836..136448254 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029699 (Srcrb4d) scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI (curated);Acc:Srcrb4d-002]

 
Come back to gene ENSMUSG00000029699


For any suggestions or comments, please send an email to unitrap@crg.es