Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR1012
Clone ID XR1012
Vector pGT0lxf
Project sanger

Sequence tag XR1012
Sequence
TTTTTAAAAAGGTTTTTTTTTTTGGCGGCGCTCAGTGCCAGGCGGGAGGCGGCAGCGGTTGGAGGCTTCGCGGGGCTTTG
CAGCAGGGACTTCGGCGGCGCCTCAGGCACCCGGGCTCTGACACGATGCGGCGAGTGGTGCGGCAGAGCAAGTTCCGCCA
CGTCTTTGGACAGGCGGTGAAGAATGACCAGTGCTATGACGACATCCGTGTCTCCCGAGTCACCTGGGACAGTTCCTTTT
GTGCCGTCAACCCCAGATTCGTGGCCATCATCATAGAAGCGAGTGGGGGAGGGGCCTTCCTGGTGCTCCCTCTGCACAAG
ACGGGACGAATTGACAAATCCTACCCTATCAGTGTGTGGCCACACAGGACCAGTGCTGGACATAGAGGTGGTGTCCACAT
AATGACCAGTTCATTTTGATGGGGATCTTTTGAAAGGGGTTTTTTTTTTTT
Sequence Type mRNA
Unitrap ID UNI2633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 114315678..114358715 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004530 (Coro1c) NM_011779 coronin, actin binding protein 1C Gene [Source:MGI Symbol;Acc:MGI:1345964]

 
Come back to gene ENSMUSG00000004530


For any suggestions or comments, please send an email to unitrap@crg.es