Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14698G7
Clone ID IST14698G7
Vector VICTR76
Project tigm

Sequence tag IST14698G7HMR1
Sequence
ATGGTCTAATGGCTGGGAAAGTGACATAGAGGAATCCAGAGGGGGTGACTGTATTTTGTGTATTGCTATTTTGGCTGACC
CCGGGGAACGCATCTCCTGGTTTGCATGGTTTTACCCAGTTCCACCCCATCCTGATTCTGGACTTAGCCCTTAGTGACAT
GCTTTGTCAATGCCACAAAGGTAAACAAAGCATATATAGAAGCTGGACAATCATTTACCCTGAAATCTGCTCTCTTGGAG
TCCANCCACCATGTTTTAATGAAGGTTGGGCTGGAATGGTCNNAGGTTTTGTGGGAAAANGCTGCTNTNANTTATTATTT
ATTTACTTGCTTATTTATTTGCTTGTGGCCCCTCAAAATTCCCTTGTTGAAGCTGANCACGTGTCTGTAATCCNNGTGTT
TGNGATGCTNANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126805380..126805793 388
 
EST/CDNA Est Name
  CN720654.1 - BX524706.1


Sequence tag IST14698G7HMF1
Sequence
CCATTAGCATCAGGTTCTGGGTCTCCTCACCTAAATCAGAGGCTAGTGGGACTTAGGACAGCTGGTGGTGGACATACCTG
GGTTCACGTATGCCGCATTAGAACCTTGACATTGGACCCCATAGGATTTATAGTAGAGAAATCACTGCAAATCAGGGCTT
TAAGGTATCCCCCACCTGGAGAGCAGCTGTTAAGTATTTACTAAAACGCCACTGCTGCTGTCCTAAAAANCN
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126805155..126805383 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]


Sequence tag IST14698G7BBF1
Sequence
CCATTAGCATCAGGTTCTGGGTCTCCTCACCTAAATCAGAGGCTAGTGGGACTTAGGACAGCTGGTGGTGGACATACCTG
GGTTCACGTATGCCGCATTAGAACCTTGACATTGGACCCCATAGGATTTATAGTAGAGAAATCACTGCAAATCAGGGCTT
TAAGGTATCCCCCACCTGGAGAGCAGCTGTTAAGTATTTACTAAAACGCCACTGCTGCTGTCCTAAAAATCAATTATCCC
TTCCTCCCTCCTAGCCNTACTGAAGCTGAGTTAGACAGACGCACAGTAACCAAATGGGGAGTAGAACACAGAGCAGTCAC
TGGTTCATGAACACCTCCCTCTGTGACCGTTCTTGCTGGCCTCAGTCTCANGANCT
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126805011..126805383 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es