Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10033G10
Clone ID IST10033G10
Vector VICTR75
Project tigm

Sequence tag IST10033G10HMF1
Sequence
GCTGTAGTCTCACAGTTAAACTAGAAAAGATCTGCCAAGCGTTTTAAGATCTAACGAGATGTTTTAAACGATGTGATACA
CACAAATTATGAGGATTATGGGAAATTATAAATGGATGTCTTAAGGTTGCTAACTCTAAGCTATGAAATTAGATAACTTA
GAATGCTTAAGATGGTAATGAAAAAATGATTTAGATAGAGAAATCTGAACTTATCAAGATAGGGTACACAATAAAATATT
TTATCTAAACACTGCCAAATACTAAAAGACTGGACTTTTAGAATGTAACTCTCATTTAATAGTTTTCATAATTGTTTCAT
GATTGTTCCTTCTGTATGTTTATTATTATAAGAGAAAGAGCCTTTTTATTCAGATAGAAAGTGGGGAATGTAGTGGGTTG
GTCTGGTGCTGCTCTGTACTCAATGCTAAATTCTGTACCCCAAGATCTGGCTGCTCCGAGATGAGCAGGTCCTCTCCTCC
CACCATGTGGTGGTCAAACTCAAGTCATCATGCTTGGTGGCAAGTACCTTCACCCTAGTTATCTTAGTTAGCAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137431869..137432423 521
 
EST/CDNA Est Name
  BX525091.1 - AW226798.1 - AW457811.1


Sequence tag IST10033G10HMR1
Sequence
TAGCTATCTAGTGTTCAATTCCATCAGAGCCCTGAGAAGGGATAAACATTACCTGAGCATGCAGGAAATGCAGAGCAGCA
GCTTCCAAGAGTACAGCAATGGCGGACAGCCGACTCAGGCTCCGAGCCACGTAACCCTCTTGTCTCTTCATGTCTGAAGT
AACAGTAAGAGCCTGGTGTAGAAGTGAAGGCGGCTGTGGTTCAAAGCCAATAGAAAAGGAGGTGTAGGCTGCTGGGCGTG
TAGCTCGTCGGTAGAGCATTCACTTGGCATGTGTGAAATCCTGAGTTCACTCCTCAGCACCACGGAAAGCAGGAATGATG
CTACCACACCTGCAGTCCTAGTACCCGAGAGGCAGAGGCAGGTAGATCAGGAACTCAAGGCCAGCCTGANCTAGAGACTG
GGAAGGAAGANGANGGANGGGGAAAAGGAAGANAAAAAGAN
Sequence Type genomic DNA
Unitrap ID UNI33931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137432420..137432859 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019054 (Fis1) NM_025562 Friend virus integration site 1 Gene [Source:MGI (curated);Acc:Fis1-002]

 
Come back to gene ENSMUSG00000019054


For any suggestions or comments, please send an email to unitrap@crg.es