Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13085D3
Clone ID IST13085D3
Vector VICTR76
Project tigm

Sequence tag IST13085D3BBF1
Sequence
CCTTCACTTGGCTTCTGGAAAGTTGCTTGGTGATAAAACTCTGTTTATTTCTAGATTTATATCGAGATTCTAGAAGAAAT
CGCACTATTTTTCTGATAGCAAATATTTTTTTGCTAGATTATGCTATTGATAATGGATTTGCCAGCATATATTATGAACA
TTGTTCATTTCTTTCCCTGTGTGTGTACATAGTCTTNAAGTGTTGCCACAGACCGGGCCTAGTTGGCCCCCCTCAATCCG
TGNNNNNNNNGGGTTCCAGCAGATGGGCACAGAGTCNGCAGGAATTGACCGACAGACNCAGACACAAGAGAGTATGAGAG
AGTGTGCTAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI23684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28997375..28997709 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]

 
Come back to gene ENSMUSG00000043535


For any suggestions or comments, please send an email to unitrap@crg.es