Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14753B7
Clone ID IST14753B7
Vector VICTR76
Project tigm

Sequence tag IST14753B7BBF1
Sequence
CAAGCAAACTCCACATTCACCTAAAGTTCTTTGGCAGTGTGACAGGAAGCCAGCTGACAGTGGCACTGAAGGCCCGAGCA
AAGGTGAGAGGACAGAAAAGAACAGACCGCCGGGAGCACCATGACAGCACGACCCAAGCAGGGCAAATGGTAGCCTCGGA
GGAAAGGATCTGCAGGGGATGTGAATCAAACAGGGACTTGGGGGTCCCCTCTTGTCTTGTTAGCTTCTAGGCCAGCCCTG
GGACCGAGGCTCCAGAAGAAAGGCAAAGGCAGAGAGGTTCACAGCCCAACTCAAAGTACTCGACTGTGGAGATCANAAAC
TCTAGCGATGGGCTCCAAACCGCCTGCCCTTGGTCAAGCTGTANGTGGGAAAATTGAAGCTCAGGGAGACCAAATCTGCA
CGGTCACCTAACCAAAAAGGCCTGTGAGGGCTGGTGCTGNGGGCTNCNNGTGCNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5106234..5106686 441
 
EST/CDNA Est Name
  BI662944.1 - CF894635.1 - BE573374.1 - BG970841.1 - BF180462.1 - BY703871.1 - CJ135813.1 - BI683636.1 - BU522889.1 - BQ886364.1 - DN176036.1 - BG294928.1 - BB638781.1 - BB658349.1 - BI647807.1 - CD560365.1 - BF788415.1 - BI251744.1 - BG243553.1 - CF893363


Sequence tag IST14753B7HMF1
Sequence
CAAGCAAACTCCACATTCACCTAAAGTTCTTTGGCAGTGTGACAGGAAGCCAGCTGACAGTGGCACTGAAGGCCCGAGCA
AAGGTGAGAGGACAGAAAAGAACAGACCGCCGGGAGCACCATGACAGCACGACCCAAGCAGGGCAAATGGTAGCCTCGGA
GGAAAGGATCTGCAGGGGATGTGAATCAAACAGGGACTTGGGGGTCCCCTCTTGTCTTGTTAGCTTCTAGGCCAGCCCTG
GGACCGAGGCTCCAGAAGAAAGGCAAAGGCAGAGAGGTTCACAGCCCAACTCAAAGTGACTGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5106234..5106530 297
 
EST/CDNA Est Name
  CF914111.1 - BB864518.1 - AW321186.1 - AW476509.1 - BY246177.1 - AW911565.1 - BB847836.1 - AA270643.1 - BY031768.1 - BY295387.1 - BY285251.1 - BY250345.1 - BY284661.1 - BB847813.1 - BY289794.1 - BY290656.1 - CJ074376.1 - CJ163262.1 - CF553107.1 - BY290903


Sequence tag IST14753B7HMR1
Sequence
GCTTGCTCCCTTGGAGTANAATTTTTATTCCTCAAGCCCAAACCCTTTGGAGTANATGGCCGGCATGCAGTTTTGCACCC
ACGTTATCTTCTTCCCTGTCTCCACTTCCTTTTTCTTCCCCAACTCGAGGCCTCAGATTTCCTTGAGGAGGCTCGAACTC
AGAAGTGGGCTTAGGAGGGGGAAGCTACCGGCTGGCTGTCAAAGAGCTTGGAATCTGACAGGCCTGGTTTCCAGTCTCAC
AGTTTTCAACTGCTTAGGGCAAGTCACCTCCCTTCTGTGACCTCTGGCTTCCTCAGTGGTTGGAAATAACACTCACCCAC
TTGTGTGCACTGTTGTGAGGGTTTANTAAAGGGTGATTTCNAGTGCTTCACACAGGGTCAGTTCCAGTTTNNTATTGACG
GCTGCTTCNNNGGCCN
Sequence Type genomic DNA
Unitrap ID UNI20803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5105824..5106238 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024870 (Rab1b) NM_029576 RAB1B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1923558]

 
Come back to gene ENSMUSG00000024870


For any suggestions or comments, please send an email to unitrap@crg.es