Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15075G2
Clone ID IST15075G2
Vector VICTR80
Project tigm

Sequence tag IST15075G2HMR1
Sequence
CNGGTCCCCTTTCCTGTCCTCACGCCTGTGCTCCTCAACCCATTAAACCTTCTAACCTTTCTAGATGTCCACATCCCATG
GTTTGGAGTAGGCATGAGACCATGAGACCAAAGATCCCAGGTAGATGACCCTTCACCCCTTCTT
Sequence Type genomic DNA
Unitrap ID UNI30940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105326049..105326190 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035547 (Capn5) NM_007602 calpain 5 Gene [Source:MGI (curated);Acc:Capn5-001]

 
Come back to gene ENSMUSG00000035547


For any suggestions or comments, please send an email to unitrap@crg.es