Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST452631
Clone ID OST452631
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST452631
Sequence
AGACGGCACCCAGCGGCTCTATACGCTCTCCAAGCGCCACTTCGTCCTTGTGTTTGATGTCTTCTTCATCTGTTTTGGAC
TGACCGTCTTCGTCGGCATCGAGGGACCCAGAGTGATCGAGACTTTGCCTGCTAATTATTCACTCAATAGTAGCAAAAAG
CTAAAGACAGTTATACCTTCAAACCCACTGTCCACATATAACCAACAACTATGGCTGATGTGCGTTGTGGAGCTGGAGCC
CTCAGAAGAAACATCCATCCAAACCAGCTTCACCATGACAGTGAAGGTCGATGGTGNGTNTCAAGATGGAACCACGACGT
NCATCCATAACAAGGTNCACAACCGGACGAGGACCCTNACGTGTGCAGGGAAGCCATCAACTCTG
Sequence Type mRNA
Unitrap ID UNI16893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6280601..6291699 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038141 (547127) NM_001033178 transmembrane protein 181A Gene [Source:MGI Symbol;Acc:MGI:1924356]

 
Come back to gene ENSMUSG00000038141


For any suggestions or comments, please send an email to unitrap@crg.es