Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15022E12
Clone ID IST15022E12
Vector VICTR78
Project tigm

Sequence tag IST15022E12HMR1
Sequence
CATTAAAAAACAAAGCAAATCTTTAAGACTAATTTATGCTTTAGGACCNAATACTCTGAGATATGATCTTCCACAGAAGA
GTGTTTAGTCTCTGAAAACCATTTCTCCTTCTCCTAGCAGCTAGCAGTTGTTAATAGATCTATAATTGGGGCGACTGCTT
GGTCC
Sequence Type genomic DNA
Unitrap ID UNI12991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33940887..33941050 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027680 (Fxr1) NP_001106659 fragile X mental retardation gene 1, autosomal homolog Gene [Source:MGI Symbol;Acc:MGI:104860]

 
Come back to gene ENSMUSG00000027680


For any suggestions or comments, please send an email to unitrap@crg.es