Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10041D3
Clone ID IST10041D3
Vector VICTR75
Project tigm

Sequence tag IST10041D3BBR1
Sequence
CAGTGACTTCATAGCTTTCTTACCTGGACTTTAACCCCTGCATGTTAAACCCTTTTCTTGTTATGATTTTTTATTCACCT
TCCCTTTCTTGGACTCCTCCCCTCCCCCAACATACACACACACACACACACACACACACACACACACACACACACACACA
CACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20440705..20440868 160
NO GENE  


Sequence tag IST10041D3BBF1
Sequence
ACTGGAGGCGACTGCACTATTTCTTCATAGATGCTGGTTAGTCCCCCACAGAGTTTGTGTGTAAAGTGTTTATTTCACAT
TTAGCATATACTTACCTTAAAGAGAAAACTTTTAAAGAGATTTCTCATAACTTTGGGGGATTCGACAGTTCGATCCTTAT
TACTCAGCCTATCTGGGGGGCCTATTGGGCTCCTGAGATTCAAGAGGGCTAGGCCTGACTTGAAACAGCAGTTCCTGTCC
CTAGTCCTGTGTGAAGTGTTTGCCTTATCCCTAAGCTGCAAGTCCCGGGAAACCCAGCAAGCTGCGTCCTATGTCAGCAG
AGCCGTCACCTGTTGGGCAGCAGAGGCGGCGACAGCCACCGCCTACAAGACACAGCCCCCATTCCTGGCGACATCAGGAC
GGATGCGGACGCTCCGGGACCTGGGCCGAGGAGGCCGGGCGCTGGAATGCGGTCTTCCCGGCGAGGGAGACTATGCACCG
GAGTGGAGACAAATTGGGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20440865..20441367 473
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es