Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14651F6
Clone ID IST14651F6
Vector VICTR74
Project tigm

Sequence tag IST14651F6HMF1
Sequence
GTGTGCTGTGCTGGGAGCAAGGCTGGAAGAGCCCAGGAAGAAAGAAGGTCCTAGGGTGGGAGTATGTCCCATAACCCACT
CCTTCTAAAGGTCCACAAGCTTCCAAGGCAGGTGTGCTGGAAAGGGCCCTGCTGAGAAAGATGGTCAGAAACTAGCACAA
AGGAACAAAGTGACTCANGATGAGGCTGGTAGATTGAAGGGAAGGGCAGCCTTTGGTGAGACCCAGACAGTGAGTGACAC
TTAGAACAGCAAACCAGTTTTTATTCNTAATAGACTCACCTATCAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24338697..24338984 284
 
EST/CDNA Est Name
  BY266924.1 - BY304250.1 - BY121952.1 - CJ106030.1 - CJ108981.1 - BY123069.1 - BY124125.1 - BY123948.1 - BB606801.1 - BB606835.1 - CJ105877.1 - CJ119629.1 - CJ107105.1 - CJ116998.1 - BY249824.1 - BB643419.1 - AI504002.1 - AI551511.1 - AW492595.1


Sequence tag IST14651F6HMR1
Sequence
NNAAAGGACACTGTCCTAGCATCTCAGTTAATCCCAGGTCTTTGGGCTTCTTGGAGCCTGTGAGCTGAGCTATAAATGTT
TGTGTTTTCCCCTGGGACCTGTGTATGTATATACATGTATGTGAGTTCCTGTGTGTGGAGGCCAGAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI16274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24338549..24338696 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]

 
Come back to gene ENSMUSG00000036473


For any suggestions or comments, please send an email to unitrap@crg.es