Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14728B4
Clone ID IST14728B4
Vector VICTR76
Project tigm

Sequence tag IST14728B4HMF1
Sequence
GTTGGGAAAGTGGTACAGGGGCCTGAGTGTACACCTCCCTAACAGCACCCGCCATGGCTGCCCTAGCGGGCTGGAGAGAA
GAAGAAGTGTTCGTACTTACTACTGCCTCCATATCAGAAGTGTCAGGCGGAGCAAACATAGACTGAACCATAAACTTGTG
TTTACTTTTCTCATTGGGATCATAATCGAAAGGCTGTAACATCACTGAGAAAGAAAATATTTCATTAGGAGGGTCACAAT
GTGGTTATCGGAGTCGTTTGTCACGCTAGGTCTTACACTGTGGAGGAAAACAGCTCCCCAGCTCTCCCATCTGGACCCTG
AGGAAGGCCGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 173596893..173597225 333
NO GENE  


Sequence tag IST14728B4HMR1
Sequence
CCAACTTTGATGAATAGCTTTAACATTTTACATGGCTGTTCTTTTCTGACTCGATGAACTGAACTTGCTTCAATTCTCTG
CTCTTGTGGACCTTCTCCTCCCTCTCCTGCACCACAGCGGCGTGCTCTATCCTGAGTGGATGCTTCTGGCCTGTCTCCAG
CCCTCATGCCCGGAAGGGTTTGCCTAACATTAAATGCCCCTCCCCTCCCCCCCANTGATACTGCCCGCTGTTGCTTTCCT
CTGCGGANCGGANNTNCTCTGGTCANCTTTGTTCTTCCCTCTTTACTGAGGACGGAGCTTGGGTCTTGTTCACACTAANC
ATCTGCTCTGTCTCTGAACAGGCCCTGCTTCTTTGTTCTTTAATTGCCTTCATTTTTATCCCTCCTTCCTCATGTAAGTA
CATGTTTAACANTGTCCCTAATTTTGGTAAAATTAAGATGCCTTCGTTTTTTATAAATAANCNGGATTTTATGGTATTGA
TTTTTCCANAN
Sequence Type genomic DNA
Unitrap ID UNI13259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 173597221..173597709 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054455 (Vapb) NM_019806 vesicle-associated membrane protein, associated protein B and C Gene [Source:MGI (curated);Acc:Vapb-001]

 
Come back to gene ENSMUSG00000054455


For any suggestions or comments, please send an email to unitrap@crg.es