Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14398A3
Clone ID IST14398A3
Vector VICTR74
Project tigm

Sequence tag IST14398A3BBF1
Sequence
CAGGTTCTCCAGGAAGGTGGGCTCAGGCACCTCGGGAGGTGAGAAGCCCAGGTCGGAGGCCATGGCCCAAGGCACCACTG
CCAGGCACCTCGAGATTCACCACTCTCCAGCACCAACTTCTAAGGGAGAGAGTGAATGTCAGGTTTCTCCATGTGATCTT
TGAGAGGTCCCACTTGTGTACATGCATATGCTATAGGCACACACACGCAAGATCAGGAAGCAACTTGAGAGAGGCAGAAA
CATCCTTGAATCTAATTGGAGAATATGTGCACAATAAACCATCCNTTCAACTTTGTAAATGTTTGATGTTCTCTGAATAT
AAAGCCAGTNNNNATAAATAAGCNNATGCAAAAATCNNCCNNCGTTCTTATNNNNACCTGCNCATCTCTGTATTNNNNNN
NNNNNTGCNNGNGANANANTGTCTCACTCNTNTNNNGCTNNCCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14398A3HMF1
Sequence
CAGGTTCTCCAGGAAGGTGGGCTCAGGCACCTCGGGAGGTGAGAAGCCCAGGTCGGAGGCCATGGCCCAAGGCACCACTG
CCAGGCACCTCGAGATTCACCACTCTCCAGCACCAACTTCTAAGGGAGAGAGTGAATGTCAGGTTTCTCCATGTGATCTT
TGAGAGGTCCCACTTGTGTACATGCATATGCTATAGGCACACACACGCAAGATCAGGAAGCAACTTGAGAGAGGCAGAAA
CATCCTTGAATCTAATTGGAGAATATGTGCACAATAAACCATCCATTCAACTTTGTAAATGTTTGATGTTCTCTGAATAT
AAAGCCAGTAAAAATAAATAAGCAAATGCAAAAATCTCCCAACGTTCTTATAAAGACCTGCNCATCTCTGTATTTTGCTC
TGTTTTGCTTGTGAGANAGTGTCTCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157204477..157204903 423
 
EST/CDNA Est Name
  W80148.1 - AA051118.1 - AA004177.1


Sequence tag IST14398A3HMR1
Sequence
CCTGCTGCGGTATGGACTCTTCCTGGGAGCCATCTTCCAGCTCATCTGTGTCCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157204900..157204958 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es