Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10876H1
Clone ID IST10876H1
Vector VICTR76
Project tigm

Sequence tag IST10876H1HMF1
Sequence
TNANACTCTACACAAAANNNTCAGTCCCCATTTCTAAACTGGGAANAATATGGCTGATGTGAAAACTGGGTAANAATGTG
TGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10876H1HMR1
Sequence
CTGAAGGTGTATAAACTAGGACGCAGAAGCCATCTCTCAGTTTTGTTGAATTGACTATCAACTGCTTGCTACATTCCTTT
TCTGACTTTTCTCATGTACGTGTGATCAGGTACCAGGCCCTGGCTGTGATCCAAAACTCTGTAAAAAGGTGACAACCGAT
AATTATAACAATGTTTTGTTGTTTCCTTTACAGTTTTAAGGTAGCCATTCATGAACATTAGTAACAATGTTTCTTTTAGC
AGCCAGCAGTGGGAGGCAGCACTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCT
GGTCTACAGAATGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCCAAAACAAACAAACAAACAAACAAAC
ACCCACAGTGTTTATTTTAACGGCTTTATAATATTTGTTTGTTTACATATATTTCTTAAACTAGTTTCTTCCTTAAGTTC
TTTCTTCCCTTCCTANTTTTTTTTTTNAACTTTN
Sequence Type genomic DNA
Unitrap ID UNI17406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87439402..87439914 509
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041079 (Rwdd2b) NM_016924 RWD domain containing 2B Gene [Source:MGI (curated);Acc:Rwdd2b-001]

 
Come back to gene ENSMUSG00000041079


For any suggestions or comments, please send an email to unitrap@crg.es