Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST452452
Clone ID OST452452
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST452452
Sequence
GGTGTGTGAAGATAACCCAGCAACATTGAAGACGTTTCTAAGGAGATATTCAGAGGATGCTCTAGGGAAGATCTGAGTAC
TGAAGAAAGGGAGAATCATGGACCAGAACAACAGCCTTCCACCTTATGCTCAGGGCTTGGCCTCCCCACAGGGCGCCATG
ACTCCTGGAATTCCCATCTTTAGTCCAATGATGCCTTACGGCACAGGACTTACTCCACAGCCTATTCAGAACACCAACAG
TCTCTCTATTTT
Sequence Type mRNA
Unitrap ID UNI16904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15639943..15641338 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014767 (Tbp) NP_038712 TATA box binding protein Gene [Source:MGI (curated);Acc:Tbp-001]

 
Come back to gene ENSMUSG00000014767


For any suggestions or comments, please send an email to unitrap@crg.es