Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0248
Clone ID XR0248
Vector pGT0lxf
Project sanger

Sequence tag XR0248
Sequence
CGCTCGCTCACCCCAGCTGCAGCCACTCTCTCCCGCGGCTGCTTCCTCCATCCTGGTATTTTTTGGAGCCTCCATCCTGG
TTCTTCCAAAGTGCCCGGACCCAAAACAGGAAAGGATCACAGATGCACAAGCATGGAGGAGAAGCAGTTTGGTTAACGTG
AGTGATGCTGCTGGCCGAAGCACAGAGGTGGGATTCTATGGGAAGGCCTGTAGCTAATCCACCTGTGGTCTAGATTTGAG
TATGAGCACAGTTGAAGAGGATTCTGACACAGTAACAGTAGAAACTGTGAACTCTGTGACGTTTACTCAGGACACGGACG
GGAATCTCATTCTTCATTGCCCTCAGAATGACCCTGATGAAGTAGACTCAGAAGACAGTACTGAACCTCCACATGAGAGG
CTTTGTTTATCCTCTGAGGATGATCAAAGCATTGATGACGCTACGCCATGCATATCAGTCGTGGCACTCCCACTTTCAGA
AAATGATCAGTGCTTTGAGGTGACCATGACGGCAATTTCTTATTTTTTCATATGATGAACTTTCTGAGGGCACTGTGACT
TCAAATTCAG
Sequence Type mRNA
Unitrap ID UNI3195

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9140386..9161725 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]

 
Come back to gene ENSMUSG00000042508


For any suggestions or comments, please send an email to unitrap@crg.es