Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST452440
Clone ID OST452440
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST452440
Sequence
GACTGAGGTGGGGTCTTTCATCCCAACTCATGATGCGCACCCGGATCGCTGCACAGGGTTTCACGGTCGTAGCCATCTTG
TTGGGGTTAGCTGGCATCTGCTATGAAGTCTCAAGCCTGAGTATAGCCGGGTCTTAAAGCGCCATGGAAACCATTACAAA
ACCCAGGAACAACAGACATCCCTGTCAGACTTGCTCCCTCCGTTTCAGACCGGACCTTATTGTCATTTGGGTGAGGAAGT
GGCCGATTTTGTAACTGATTTGCGCTTCCACCGCTGCCCCCTCCCGCTCCCAAAATCCCAGGTTCATTTCAGTTGGGTTG
CATGCTTCTATTTGTGATGCGTCCCCTTAATTACTTAATAAAAGCTTATTACACTTGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54692152..55044139 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025868 (Higd2a) NM_025933 HIG1 domain family, member 2A Gene [Source:MGI Symbol;Acc:MGI:1914294]

 
Come back to gene ENSMUSG00000025868


For any suggestions or comments, please send an email to unitrap@crg.es