Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14559F4
Clone ID IST14559F4
Vector VICTR74
Project tigm

Sequence tag IST14559F4HMR1
Sequence
TNNNCCTTCTGGCCTGTGAAATGGACACAATACGGAACATCAGTATTCTTGGGTGGCGGCGGGAGAGAGGTAGCGGGGGC
GGGGCTGCCACNNNCCNNCCCCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14559F4BBF1
Sequence
AAGGAACAGCTTGGGGGGGAGGGGCAGTCAACAGGAGGAGAATTCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI36012

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121151488..121151538 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029603 (Dtx1) NM_008052 deltex 1 homolog (Drosophila) Gene [Source:MGI (curated);Acc:Dtx1-001]

 
Come back to gene ENSMUSG00000029603


For any suggestions or comments, please send an email to unitrap@crg.es