Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10324A7
Clone ID IST10324A7
Vector VICTR76
Project tigm

Sequence tag IST10324A7HMR1
Sequence
TCAAGACANNNGNCCTTTCAAAACACTATAGATATTTTAGGCTCCAGTTTCACAATGCGGGCATAAGGCAACAACTACAT
TCACAGGTAAAAGCCATCTCCATCTCCCCCAACTCTGCCTGACTGGTAAGACCCCTCAACCTTCCTATCTCAGCACTCCA
ATCTCACCTCAATAAAGAGAGGGAAGCANACANAGAGCTGGGCATCCCTTCANAAGGGACNAGGGAAAGAGATTGAATAC
CTANCAGAGATTTCCTACCCGACATACACCTTCTCCTTCCTCTCCTGGTATCTGCATCTGACTGTCTTCANCCCTATCTC
CACCTCTGCCTCCACCTCCAAGCACAGGACAAGCAAAGGAATCAAATAAACACACCCTCACTGCATCCAGAGANANGCCT
CCCCTCTCCCTGCCCACCACACATTCATTTCCTCACTCCACACTCAGAGCTCATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106623116..106623571 432
 
EST/CDNA Est Name
  BY569312.1


Sequence tag IST10324A7HMF1
Sequence
ACTGCTGCTCAGAGGTGCTCTGTTGCCACACACCACTGATTACAGTCTCGCTTGTTTAGCTGGGCCTCCAAGAGTGAGAA
GAGCGGCCTCATTCCATGAGAAAAGGCTCTGCACCTCCTCTTGAAGCCACTTAGTCCCAACTCAAAGGCTCTTCCTAAAT
CCTTCTGCGTAGGAGGGGTGGGCATGGAGAAGTGCAGTGGTTCTCTGCTTGCCCCACACCTCAGTGACTGACATCTCCCC
ATANCCTCATTTTGTCACCTGTATGGTTCAGTTGTCTANCCCTTTCCCCTCTTCATCCANNCCCCTCCCTGTTTAGCTTC
CTGANAATGGTAAAACCCTTGTGAGTTGTTCTATCAAAATCTACACCTTTGCATTGCAGTGGTGTTTGGAGTGTGAATTG
TTATGTAGTGTTATTTTGTGAAGTGGTCTTGATTGTCCCTTGTCCCTAATTGGCATGTGTCACTGANAGTCGGCANGCAA
NCAGANTCCTNTTCTGANTTTCACGGTNANCACTTCTCCCTACCAGTGCTCTNNGGN
Sequence Type genomic DNA
Unitrap ID UNI15948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106623580..106624111 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061887 (Ssbp3) NM_198438 single-stranded DNA binding protein 3 Gene [Source:MGI (curated);Acc:Ssbp3-001]

 
Come back to gene ENSMUSG00000061887


For any suggestions or comments, please send an email to unitrap@crg.es