Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST452424
Clone ID OST452424
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST452424
Sequence
GACTGAGACTCCGGCAGAGTTCCTCTGTCTCGTCTTGCCGATTGAAGGTCCCCGTTTCTCCAATTTCTCTCCATCTTCTG
GGAGGTAGCAGGAAATCAGAATCATGGTTGGTTTCAAGGCCACAGATGTGCCCCCAACAGCCACTGTGAAGTTCCTGGGG
GCTGGGACAGCNTGCCTGCATTGCAGATCTCATCACTTTCCCTCTGGATACCGCCAAGGTCCGGCTGCAGATCCAAGGGG
AGAGTCAAGGGCTAGTGCGCACCGCAGCCAGCGCCCAGTACCGTGGCGTTCTGGGTACCATCCTAACCATGGTGCGCACT
GAGGGTCCACGCAGCCTCTACAATGGGCTGGTCGCCGGCCTGCAGCGCCAGATGAGCTTTGCCTCCGTCCGCATTGGCCT
CTACGACTCTGTCAAACAGTTCTACACCAAGGGCTCAGAGCATGCAGGCATCGGGAGCCGCCTCCTGGCAGGTAGCACCA
CAGGTGCCCTGGCCGTGGCTGTAGCC
Sequence Type mRNA
Unitrap ID UNI14303

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107645236..107646651 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]

 
Come back to gene ENSMUSG00000033685


For any suggestions or comments, please send an email to unitrap@crg.es