Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST452406
Clone ID OST452406
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST452406
Sequence
GACTGAGGATCTTCTGCCTATTGNGCCACATAGTGANNAGCCCATNACNTGAANACATGNATTGCATTNNGNAAAGTGAG
NACACGACTGNCAGGCNCAGNCCCNGGACNNGTGCCACAGTGCGTCGNTGCATGAGATTAGTCNCTGNCAGGGNNTGTNN
ATTATCAGTGATGGNNGCTGCTNGNTTCGTATCCNACCCCTNAGAAGCATGACAGTGATAATTATGAAGTTTTATTCAAC
CTGGAAGAACTTAAATTGGATCAGCCTTTCATTGATTGCATCAGAGTTGCTCCTGATGAGAAATACGTGGCTGCCAAGAT
AAGGACGGAGGATTCTGAAACCTCCACCTTAGTAGTTGTGAAGCTCAGTGACCAGCCTGTAATGGAAGCGTCGTTCCCAA
ACGTGTCCAGTTTCGAATGGGTGAAGGATGAAGAAGATGAAGATGTCTTATTCTACACCTTCCAAAGGAACCTTCGCTGC
CACGATGTGTATCGAGCCACATTTGGTGACAACAAGCGCC
Sequence Type mRNA
Unitrap ID UNI16906

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 85477861..85482657 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024127 (Prepl) NM_145984 prolyl endopeptidase-like Gene [Source:MGI Symbol;Acc:MGI:2441932]

 
Come back to gene ENSMUSG00000024127


For any suggestions or comments, please send an email to unitrap@crg.es