Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13056F12
Clone ID IST13056F12
Vector VICTR76
Project tigm

Sequence tag IST13056F12HMR1
Sequence
AGCACAGAGCCGTGTACTCTGAGGGCGGACAAGAAGACTAGGAACCGTANTNGTTTCTATNNNTCTAAGGTTANNNNNNA
TTAGCGCAATAATTATTGCATATCCATGAGGCACCACGTGTAAGGTTTCAATACATGAGTGAGTTATCTAACAAACAAGT
CAAGATGATTGGCACATCTCTCAGGAGCTAGGGTCCCATATTCAGTGCAGCCCAGGCTGGCCTATAGCTTACAGTCTTCC
TGCCTTAGCCTTCTGAGGGCTACATGGGCATGGTGTGTCACACACCACACTCTGCCAGAGCCTGCATTTTCAGTGAGAGC
CACACAGGTGCTCTGTAAACTCCATGCCGGCAGTCTTGCTTTTGTCTCCTGTCTTGTACCGACAGGGCCTTCTCAGANGA
ACCTCGCTCGCTTTACCTANGGAAGCCGCTTATCCCTGGTGATGGCCCACCATCCCGGANTTCCTTCCCACTGTCTTTTT
TTTTTTTTTTTTTNTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI16702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58154968..58155466 469
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050222 (Il17d) NP_665836 interleukin 17D Gene [Source:MGI Symbol;Acc:MGI:2446510]


Sequence tag IST13056F12HMF1
Sequence
TGCAGTGTGTATCACTGACAGGCAGGCTGTAGTCCAGGCAGCTTTTGCTTGTTGGTGTGACCTAAGGAGTAAGGTTACAT
AGCTGGCTTGGAACACTTTGGGGGACACACCGTGGA
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26647378..26647492 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es