Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST452397
Clone ID OST452397
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST452397
Sequence
TACAAGAAAATTGCTCACTATCCCTCCACTGTGATGTACTGTCTTGTTCATTCTGCTTGGAAACAACTGGTGCCAGCACA
TCATGCCCGTGAGCCCCAGGTCCCTCCAGATGTCCCTGGAGATCTCAGCGTTCCTGCTCCCTAGGGCTGTTGCTTCTGTC
CAGGGGACCACCTGGCTCCACCCCAGGGTCATCTGTGTAGAACTGCTGCCGCCAGGCCACTTCACCCGTAGCCTTGCAGT
GACACCTTCAGCCAACCTTTCCTGGAACTAAGNNGTCCATCTTTAAGNCTTGATCTCTGGANGGTGTTGNCACATGAGCC
AGCANGAANANGGCAGTGCTGCNNNANTNCACCCTCCTACTATGGAAGAACTATACCCTGA
Sequence Type mRNA
Unitrap ID UNI16910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24494868..24501529 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024130 (Abca3) NM_001039581 ATP-binding cassette, sub-family A (ABC1), member 3 Gene [Source:MGI (curated);Acc:Abca3-001]

 
Come back to gene ENSMUSG00000024130


For any suggestions or comments, please send an email to unitrap@crg.es