Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0064
Clone ID XR0064
Vector pGT0lxf
Project sanger

Sequence tag XR0064
Sequence
CAAACCTTTGTTCTGGCTCCAGAAGGATCTGTTCCCAAATAAATTTTATGTTCACAATGATATGTTTCGTTATGAAGATG
AAGTGTTTGGTGATTCTGAACCAGAACTTGATGAAGAGTCAGAAGATGAAGTGGAAGAGGAGCAAGAAGACAGGCAGCTG
TCTCCTGAACCTGTGCAAGAGAATGCTAACAGCGCTTACTATGACGCACACCCCGTGACTAATGGCATAGAGGAGCCTTT
AGAAGAATCCTCTCATGAACCTGAGCCTGAGCCAGAATCTGAAACAAAGACTGAAGAGCTGAAACTCTCAAGTGGAGGAG
AAACACTTGGAAGAGCTGGAGG
Sequence Type mRNA
Unitrap ID UNI3198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92493410..92497374 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es