Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12881B9
Clone ID IST12881B9
Vector VICTR76
Project tigm

Sequence tag IST12881B9HMF1
Sequence
GCCTTGGGGTNTGTGCANAAGCTCAAAGAAGCAACCTGGGAGTTGAAGTTACCCACACCCAAGCATGCCTAACCAGCTCT
TGGGAAAGTCCACAGTGTCTTGAGTTGCTGTACCGCCCTCTCATGCACATACCGTTAATGGCTACCACCTCTTGGTTTTA
CAGATATGAACCTAAACTTTCAAAACCTGTCAGTTATGGGACTCCGAATCCTCCTGCTGAAAC
Sequence Type genomic DNA
Unitrap ID UNI36015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54842503..54842724 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000076928 (A430107P09Rik) T-cell receptor alpha C gene segment [Source:IMGT/GENE-DB;Acc:TRAC]

 
Come back to gene ENSMUSG00000076928


For any suggestions or comments, please send an email to unitrap@crg.es