Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13682B1
Clone ID IST13682B1
Vector VICTR74
Project tigm

Sequence tag IST13682B1BBF1
Sequence
CATGTATTATGATATGTATATATTGTGGTGTGTATATGTGTGTTAGTGTGTGTGTCCATGGATGGGCAAAAGATTATGAA
GTCAATTCTCTTTCCATCTTTAGATGGGTTCCCGGGATTTACCANATTTGTACGGTAAGGATTTTACCCACTGANCAACC
TCACCCGCCCCTGCACTAATTTTTGTACTGTATTGTATTGTATTTTTTCTCTTGTATTGTATTGTATTATTTANATACAG
GGTTTTTCCTTGGCTGCTGCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136425734..136425993 254
NO GENE  


Sequence tag IST13682B1HMR1
Sequence
NANNNNCNACTTANCNNNNNNNNNNNNNNNNNNNGTGTGAGCTTTTGTAAAGGTGTAGTGAATGGCAGGAAAGAACTGTG
TCTCAGATGTCCCTGTTTTAGAAAGTAACGGCAAGAAATGTGAAATGCAGGTGCAGGTGGTGGGACAGGCTCAGGAAATG
AACCACAGCCTGAGGGCATGTCTGCTGAGGTGGCTTCAAAGGAGGTTCCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI6893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86352342..86352521 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020516 (Rps6kb1) NM_028259 ribosomal protein S6 kinase, polypeptide 1 Gene [Source:MGI (curated);Acc:Rps6kb1-001]

 
Come back to gene ENSMUSG00000020516


For any suggestions or comments, please send an email to unitrap@crg.es