Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14983E6
Clone ID IST14983E6
Vector VICTR76
Project tigm

Sequence tag IST14983E6HMF1
Sequence
GCTCTGGCTATCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCGAGTG
CTGGGATTAAAGGCATGCGCCACCACGCCCCGCTAGTATCCTTTTCTAAGATGCTAGCTCCTCATCTTTGTGAGAGATAA
CATTGCACTTACCATGTCTGAAGTTATGAGCTTGCTTGAGCTAACCTCACAGCATCCAGCGAAGACACTAAGAACAGGTC
ACACAGAAACACTGAGATCAGCTGATTTACACAGAGGAACATGCAGGCTTAGTACCTGGAAGAGTCACTGCCTCTTCTGA
CTGGCAACTCCTTGCGGAGGTTCTGATGGCTATTGAGTCTTATTGAAATGAGCACCACCCTTANGGTTAGAGTGTGCTGA
AGGGACACAGCAGANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177359502..177359915 412
 
EST/CDNA Est Name
  CJ050500.1 - BM125820.1 - CN690235.1


Sequence tag IST14983E6HMR1
Sequence
NNNCTATACAGAGAAACCCTGTCTTGAAAAAACAAAAAATAATAAAAAAAT
Sequence Type genomic DNA
Unitrap ID UNI30717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177359455..177359502 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]


Sequence tag IST14983E6BBF1
Sequence
GCTCTGGCTATCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCGAGTG
CTGGGATTAAAGGCATGCGCCACCACGCCCCGCTAGTATCCTTTTCTAAGATGCTAGCTCCTCATCTTTGTGAGAGATAA
CATTGCACTTACCATGTCTGAAGTTATGAGCTTGCTTGAGCTAACCTCACAGCATCCAGCGAAGACACTAAGAACAGGTC
ACACAGAAACACTGAGATCAGCTGATTTACACAGAGGAACATGCAGGCTTAGTACCTGGAAGAGTCACTGCCTCTTCTGA
CTGGCAACTCCTTGCGGAGGTTCTGATGGCTATTGAGTCTTATTGAAATGAGCACCACCCTTANGGTTAGAGTGTGCTGA
AGGGACACAGCANANTGGTTCCNGCCTGGGCCAATCCTTTTCCAGANCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177359502..177359951 440
 
EST/CDNA Est Name
  CJ050500.1 - BM125820.1 - CN690235.1

 
Come back to gene CJ050500.1 - BM125820.1 - CN690235.1


For any suggestions or comments, please send an email to unitrap@crg.es