Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14433A5
Clone ID IST14433A5
Vector VICTR74
Project tigm

Sequence tag IST14433A5HMF1
Sequence
AGGCAAGTGGGTAGAGGACACAGGTTGTATCTGAAGACTACACAAGTAGCTTGCTTGCCTTCCTTCCTTCCTTCCTTCCT
GCCTTCCTTCCTTCTTTCTTTTCTTTATGGTTTTTTGTTTGTTTGGTTGGTTGGTTGGTTGGTTTTTGTTTTNCNANANN
NGGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62265899..62266063 153
NO GENE  


Sequence tag IST14433A5HMR1
Sequence
GCCTTTGAAAGTNNGAGACATGGCAAGCACACTGATGTGTGCCTGTGTAGTTCTTCAGTTTAATACCTTATTGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62265825..62265902 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es