Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14475H9
Clone ID IST14475H9
Vector VICTR74
Project tigm

Sequence tag IST14475H9BBF1
Sequence
ACACTAACAAAACGTCTCAACTTCAAGGTGAAATGCTTGACTCCTANACTTGTGACCCAGCAAAGTGCTCTATAGGTAGG
GTTACTAGGTCANAGAGTCTTGCCTGCAAACCACAATTATACAATTCCACCAAATGTAANACATGTAAAAATGACTTATT
TAGCTCAGGTTTTGAAAATTAAAAATCAAACCCACAAAGACCTAACTTTCACATTAAGTACAAATGTTTAACATATATAA
CATGTTTTGCCTTGATATATGAAATCATATGACATCACCTGACAGGAAACTTAANTTTATTTGANCNACANTCANCCTAN
GGTAGGCCTANCNCATGATCANGATAGTGCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113022397..113022746 326
 
EST/CDNA Est Name
  CJ069403.1 - CJ137485.1 - CJ055239.1 - AA914643.1 - CJ054056.1 - CJ066700.1 - AI197240.1 - BM877271.1 - CJ090773.1 - CJ056618.1 - CJ053907.1 - CJ047273.1 - BE944913.1 - CJ094069.1 - CJ054541.1 - BI068019.1 - CJ058002.1 - CJ055890.1 - BY016448.1 - CJ048065


Sequence tag IST14475H9HMR1
Sequence
ATACTNAAATAAGGNAAGGACAGAAAATGTAGTTTTGGAAAATAATAGACTGTATCTTAAAATGATATGCTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI20489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17758896..17758974 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es