Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14272G8
Clone ID IST14272G8
Vector VICTR74
Project tigm

Sequence tag IST14272G8HMF2
Sequence
CACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTTGTTACGGATGGTTGTGAGCCACCATGTGGTTGCTG
GGATTTGAACTCTGGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCTTTTCCTTTTT
TCTTTTAAGATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTGGTTTTTCAAGACAGGGTT
TCTCTGTNTAGCCCTGGCTGTCCTGGAACTCACTTTGTANACCAGGCTGGCCTCGAACTCANAAATCCNCCTGCCTCTGC
CTCCCAAGTGCTGGGATTAAAGGTGTGCACCACCACGCCCAGCTTTNANATTTATTTATTTATTAATTATATGTAAGTAC
ACTGTANCTATCTTCGGNACACCCCATANNANGNCATTANCTCTNACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14272G8BBF1
Sequence
CACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10238 UNI11954 UNI31310 UNI31311 UNI31312 UNI31313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6417288..6417331 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6144146..6144189 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3251553..3251596 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8219624..8219667 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037669 (1110057K04Rik) NM_172401 RIKEN cDNA 1110057K04 gene Gene [Source:MGI Symbol;Acc:MGI:1916082]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5299702..5299745 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12776405..12776448 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8056405..8056448 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4688829..4688872 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004069 (Dnaja3) NM_023646 DnaJ (Hsp40) homolog, subfamily A, member 3 Gene [Source:MGI (curated);Acc:Dnaja3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3261568..3261611 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3494115..3494158 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3854619..3854662 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024843 (Chka) NM_013490 choline kinase alpha Gene [Source:MGI (curated);Acc:Chka-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11321859..11321902 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19909994..19910037 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11073362..11073405 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6626120..6626163 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5681016..5681059 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029757 (Dync1i1) NM_010063 dynein cytoplasmic 1 intermediate chain 1 Gene [Source:MGI (curated);Acc:Dync1i1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3207917..3207960 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 10074662..10074705 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 16142487..16142530 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2062..2105 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 158107..158150 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069661 (AC140325.3-201)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5486424..5486467 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144675..144718 44
NO GENE  

 
Come back to gene ENSMUSG00000069661


For any suggestions or comments, please send an email to unitrap@crg.es