Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14640C10
Clone ID IST14640C10
Vector VICTR74
Project tigm

Sequence tag IST14640C10HMR1
Sequence
NGGGAAGCCNGGGAACTGCTATGTGGGGGTTTCATGACTGTTTCACAAGTAGTCCTCTTTGCGATGAGGACATTTTTAAC
ACCATATCCTTGGTACTGTCAATGTACATTATTTGCCTTTTGCTAAATCACTTTTTCTAAGAACGCGTAAAATTGGGCCT
GGGGGAGGAATAGTACTGAAACTC
Sequence Type genomic DNA
Unitrap ID UNI36019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93748750..93748931 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]

 
Come back to gene ENSMUSG00000059474


For any suggestions or comments, please send an email to unitrap@crg.es