Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14502B4
Clone ID IST14502B4
Vector VICTR74
Project tigm

Sequence tag IST14502B4BBF1
Sequence
GCATGCTCGTCTGGGTTGGATATTCAAGANTGGCAGTCTTCAAGCCCAGCGTGGTGGCNCACGCCTTTAATCCCAGCACT
CANAANANAGAGGCAGGCANATTTCTGAGTTCGAGGCCNGCCTGGTCTACAAAGTGAGTTCCAGGATAGCCNGGGCTATA
CAGANAAACCCTGTCTCAAACACCCCCCCCCCAAAAAAANGNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14502B4HMF2
Sequence
NCATGCTCNTCTGGGTNGNATATTNAAAANTGGCAGTCTTNAAGCCCANCGTGGTGGCGCACGCCTTTAATCCCANCACT
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14502B4HMR1
Sequence
CATGCTATCCAGTACTGTGTTTGACTTTAACTCCTTTTGTCTCCTGTTTGTGATAGTAATCACTATTTTTAAAAATTCTT
TTAAAAAGGATTTATTTAATGTATGTGAGTACACTGTCACTCTCTTCAGACACAGAAGGGCATCAGATCCCATTACAGAT
GTTGTGAGCCACCATATGGTTGCTGGGAATTGAACTCAGGACCTGTGGAAGAGCAGTCNGTGCTCTTAATGGCTGANCCA
TCTCTCAAGCCACGTAGTAATCACTATTTTAACATGGCAATCTGAACTCNTANTTTTATATTAATAAATGTGTTTTTCAC
ATCATCTCTATACAGTAAATTGCAATACCCTCCTTTTATTCAGACTAAAAAAACCTTCCAGTCCTCANTAAGCCACCATA
TCTAATCTCATCANCAGATTCTAGCTCTTCAAAGTTTCCCCNAANNNNGATCCTTTCCNANANGATTATTGCTTCNCATC
CCCNTCNTGTGTAGTTN
Sequence Type genomic DNA
Unitrap ID UNI36020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 48185686..48186181 462
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037526 (D14Ertd436e) NM_172599 Uncharacterized protein KIAA0831 [Source:UniProtKB/Swiss-Prot;Acc:Q8CDJ3]

 
Come back to gene ENSMUSG00000037526


For any suggestions or comments, please send an email to unitrap@crg.es