Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0007
Clone ID XR0007
Vector pGT0lxf
Project sanger

Sequence tag XR0007
Sequence
GTGGATGCTGAGGTAGATGTGACCAGAGATATTGTCAGCAGAGAGAGAGTGTGGAGGACAAGAACAACTATTTTACAGAG
CACAGGAAAGAATTTTTCAAAGAATATTTTTGCAATTCTTCAATCTGTAAAAGCCAGAGAAGAAGGTCGTGCCCCTGAAC
AACGGCCAGCTCCAAATGCAGCCCCCGTGGATCCTACATTGCGTACAAAACAGCCTATTCCAGCTGCTTACAACAGATAT
GACCAAGAAAGATTCAAAGGCAAAGAAGAAACGGAAGGCTTTAAGATCGATACTATGGGCACCTACCATGGCATGACACT
GAAATCTGTAACG
Sequence Type mRNA
Unitrap ID UNI2772

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 145514755..145524858 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026361 (AC175246.2) NM_145991 Parafibromin (Cell division cycle protein 73 homolog)(Hyperparathyroidism 2 protein homolog) [Source:UniProtKB/Swiss-Prot;Acc:Q8JZM7]

 
Come back to gene ENSMUSG00000026361


For any suggestions or comments, please send an email to unitrap@crg.es