Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11012C7
Clone ID IST11012C7
Vector VICTR76
Project tigm

Sequence tag IST11012C7HMF2
Sequence
AACCAATTTTTAATTACCAATTAATAACAATTATAAAANCTTTATTTTTTGTAGAAACTTTTGTAGTAAACTAAAACCCT
AAGTAATAAAAGGATATTGTCTCTGAATCTTTTGGGTGAGAGCAAGGATTTAAGGTAAACTTTAAGAAGCATTAGTTAAT
AAAATACCTA

Sequence Type genomic DNA
Unitrap ID UNI30626 UNI31094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 81750020..81750188 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 23266578..23266746 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 15071053..15071221 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29592843..29593011 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88520921..88521089 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89635829..89635997 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060961 (Slc4a4) NP_001129732 solute carrier family 4 (anion exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:1927555]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 77222840..77223008 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028399 (Ptprd) NM_001014288 protein tyrosine phosphatase, receptor type, D Gene [Source:MGI (curated);Acc:Ptprd-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95202169..95202337 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 113590033..113590201 167
NO GENE  


Sequence tag IST11012C7BBF1
Sequence
AACCAATTTTTAATTACCAATTAATAACAATTATAAAAGCTTTATTTTTTGTAGAAACTTTTGTAGTAAACTAAAACCCT
AAGTAATAAAAGGATATTGTCTCTGAATCTTTTGGGTGAGAGCAAGGATTTAAGGTAAACTTTAAGAAGCATTAGTTAAT
AAAATACCTTTTACTTANGAAACAATATACACTGAAAGATTAAAACTCTTGGCTTCTTGTATAGAAGCAGAAACAATAAA
ATTTTTTCTTACATAATGTAAAGTTACATTANCCATACCTAGAGGCAAAATTTTCTAGTGATTACAGTTCACTANAANCA
AAACTCTTTGAATTTAAGCATTATTTTAAACATCTGANTAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI31094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89635829..89636195 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060961 (Slc4a4) NP_001129732 solute carrier family 4 (anion exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:1927555]

 
Come back to gene ENSMUSG00000060961


For any suggestions or comments, please send an email to unitrap@crg.es