Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0002
Clone ID XR0002
Vector pGT0lxf
Project sanger

Sequence tag XR0002
Sequence
TTTTAAAAGGGTTTTTTTTTTTTTGTTTTTTTTTNATCGCTATAAGAGCAAATATCGCAGCATCATGTTCAACCTTAAGG
ATCCTAAGAATCAGGGGCTCTTCCATCGTGTTCTTCGAGAAGAAATCTCCTTGGCAAAACTTGTCAGAATGAAGCCTGAA
GAACTTGTATCTAAAGAGCTTTCTATGTGGACAGAGAAGCCCACAAAATCTGTGATAGAATCCAGGACTAAGTTGCTTAA
TGAAAGCAAGAAGAACAGTAGTAACCAGAAACCATT
Sequence Type mRNA
Unitrap ID UNI3202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180407975..180409454 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es