Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14839E10
Clone ID IST14839E10
Vector VICTR76
Project tigm

Sequence tag IST14839E10HMR1
Sequence
NGGNNANTNANANNNNCNNNNNNNGCNANNNCACCTNNNGGTGGNGNNNNANTGNAAGCGATCATGACCNTAATTTTTAA
GAATTTTGGGAGATTAACAAGGGACCAATTCTAAGACTCTCTGGTATAAAAGAAGGAATTGATATAAAACTAAGGCATAN
AAAAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17555616..17555726 107
NO GENE  


Sequence tag IST14839E10HMF2
Sequence
GCCCCGGCTGTTCTGGGACTCACTCTGTAGGCCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCAAGTG
CTGGGATTAAAGGTGTGCGCCACCACTGCCTGGCGCTTCTATTTTTTTATTGTTATCTGAATGCAATCATCACTCAATTT
CATCTTATTCAACCTGAAGAATTTTTTGCCCAAGTTGTTTCTTTTGTTTGTTAGTTGTTGGGAAGCCCAGGCTGGCCTCA
AAAAATCANATAGGATCGTGCATTCATTCCTTTTCTCATTTNNGTGAA
Sequence Type genomic DNA
Unitrap ID UNI18681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17555779..17556065 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]


Sequence tag IST14839E10BBF1
Sequence
TTGGTGACTAAACCTATGCTTCCTCTACCTTAAGACAAGGTTCCCAGTTGCTCCTAGTCTGTCTAACACCAACACCCATA
CACTATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 74163175..74163264 90
NO GENE  

 
Come back to gene ENSMUSG00000047786


For any suggestions or comments, please send an email to unitrap@crg.es