Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12842A3
Clone ID IST12842A3
Vector VICTR76
Project tigm

Sequence tag IST12842A3HMR1
Sequence
GTTCCACCACACCTTTAATCCCAGATGAAAGGCATAGCCCAGNTTAAAGGTGTGTTCCTTAACTCGGAGATTCAATCTTC
TGGAATCCATAGCCACTATGGCTCAAGATCTTCAAACCAAGATCCAGATAAGGATCTCCAAGCCTCCAGATAAGGGTCAC
TGGTGAGCCTTCCAATTCCGGATTGTANTTCATTCCAAAN
Sequence Type genomic DNA
Unitrap ID UNI30944 UNI30945 UNI31256

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16612277..16612475 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6149264..6149462 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19465581..19465779 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9510606..9510804 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3020518..3020716 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 5074133..5074331 195
 
EST/CDNA Est Name
  AI644954.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 30939815..30940013 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022240 (Ctnnd2) NM_008729 catenin (cadherin associated protein), delta 2 Gene [Source:MGI Symbol;Acc:MGI:1195966]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56287874..56288072 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66654187..66654385 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4658308..4658506 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17092594..17092792 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054366 (Prune2) prune homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3850268..3850466 195
 
EST/CDNA Est Name
  AI930322.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 23941434..23941632 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8415653..8415851 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 62663280..62663478 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7731247..7731445 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19355173..19355371 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7260228..7260426 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20423890..20424088 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4737803..4738001 195
NO GENE  

 
Come back to gene AI930322.1


For any suggestions or comments, please send an email to unitrap@crg.es