Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XQ0491
Clone ID XQ0491
Vector pGT0lxf
Project sanger

Sequence tag XQ0491
Sequence
TGCCCCAGCCCAACCCCAGAGCGGGAGCTCTTGGCTAGAGGAAGTAGAGGGGCCGTGGGATGTGGAGAGCCGAAGGCTGA
CTCCAGGAGAGCAGAACAGAGAGCTGCCAGCGAACAGACGCAGGTAGACGAGCCCGTACCTTCCAGGATGAGCAGTGCTG
CCCCTGCTAAGAAACCTTACCGTAAGGCGCCTCCAGAGCACCGAGAGCTACGCCTGGAGATTCCCGTGTCCCGGCTCGAG
CAAGAGGAGTCCCTGACTGACGCAGAGCGGATGAAACTTTTGCAGCAGGAGAATGAAGAACTTCGCAAACGCCTGGCCTC
AGCTACCAGACGCACTGAGGCCTTGGAGCGGGAGCTGGAAATAGGACAAGACTGCCTAGAACTGGAGTTAGGACAGAGCC
GTGAGGAGCTGGACAAGTTTAAGGACAAATTCCGCAGGCTACAGAACAGCTACACGGCATCCCAGCGGACCAACCAGGAA
CTGGAGGACAAGCTGCACGCACTG
Sequence Type mRNA
Unitrap ID UNI1224

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46398085..46419318 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

 
Come back to gene ENSMUSG00000012296


For any suggestions or comments, please send an email to unitrap@crg.es