Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11748A4
Clone ID IST11748A4
Vector VICTR76
Project tigm

Sequence tag IST11748A4BBF1
Sequence
AGCGATGCACTGCCTCCCTCTGCTCTGTTACCTCCGAGCGCCTCCTCGGCGGGCGCTGTGCGAGGTGTGTCAGGCGGAGT
AAAGAATCCAGAATCTTTATTTTTGTCTTTTCCAGCATTGAACACTGGTCAGGGAGGTTTGCTCCTGACCCACCCGGAGA
CTCATCCGCTTCCGGCAGCACTTCCTGCCGCGGTAGTGCCGGAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72887500..72887703 204
NO GENE  


Sequence tag IST11748A4HMF1
Sequence
AGCGATGCACTGCCTCCCTCTGCTCTGTTACCTCCGAGCGCCTCCTCGGCGGGCGCTGTGCGAGGTGTGTCAGGCGGAGT
AAAGAATCCAGAATCTTTATTTTTGTCTTTTCCAGCATTGAACACTGGTCAGGGAGGTTTGCTCCTGACCCACCCGGANA
CTCATCCGCTTCCGGCAGCACTTCCTGCCGCGGTAGTGCCGGAGCAGCGAAGGGACGGCGGCTCGCGGGGCCCAATCTTA
GTGGCATGTGTCCGCCTACAAGAAAGTGAGGGGCGGGCACCGTGGGCTGCAGGTAGCCGGGGAGGATGGAGTCCCAGGCC
GCCGACTATAACCCGGCCTCCCGCAATCTCCACGGCAGCTCGGGAGAAATGAAGCTGCGGAGGANGAAGTCCAGGCAGTA
CGTGAGCGCGCANGANAAACGCTCTCCGCGCCGTGGTGANTGCCGGGCTCACGGCANANCTCGGGGCACCTGGGACTACA
CAGCGTGGTGGCNATGANCTCANGCTCGCTGAN
Sequence Type genomic DNA
Unitrap ID UNI35307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72887192..72887703 492
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079469 (AC158997.2) NM_018889 GPI mannosyltransferase 3 (EC 2.4.1.-)(GPI mannosyltransferase III)(GPI-MT-III)(Phosphatidylinositol-glycan biosynthesis class B protein)(PIG-B) [Source:UniProtKB/Swiss-Prot;Acc:Q9JJQ0]

 
Come back to gene ENSMUSG00000079469


For any suggestions or comments, please send an email to unitrap@crg.es