Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10070G4
Clone ID IST10070G4
Vector VICTR75
Project tigm

Sequence tag IST10070G4HMR1
Sequence
AGANCAGGCCTTGATAGAAAACTGACATTATTTTAATTTCTTCTCAGGCTTAAGATACTCACTTTCTGCTTGAAGCCGGG
AATGAGATGTGTGGAACCCAGGAGTGTGTGTGGAGTAGACACCAATGCGTTGTGATAGTGAGGATTTTGAAGATACGACA
GAAAAACCAGGCGTTTTGATTTCTGAGGTAAAAGTAGGCTGTAAATCTATTTTGTGAAAGGAGGGAAGACTCAGGCCAGA
AATCTTGTATGCTATGGTTC
Sequence Type genomic DNA
Unitrap ID UNI36029

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23972313..23972571 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031540 (Myst3) NM_001081149 MYST histone acetyltransferase (monocytic leukemia) 3 Gene [Source:MGI (curated);Acc:Myst3-002]

 
Come back to gene ENSMUSG00000031540


For any suggestions or comments, please send an email to unitrap@crg.es